Heat

1) Environmental stress: Heat. In severely hot climates, core body temperatures can rise to fatal levels. When body temperatures rise to at least 105 to 107 degrees fahrenheit, hyperthermia can set in which can result in death. Other things such as heat stroke and heat exhaustion can cause the internal organs to deteriorate and/or shut down.
2) Developmental adaptation: When living in areas where the air temperature is usually high, people tend to have longer limbs in order to release the most heat because longer limbs indicate more surface area and more surface area indicates a more rapid release of body heat.

Cultural adaptation: When people live in warmer climates, they tend to wear outfits that allow the most skin to breathe and release heat such as dresses, shorts, tank tops, flip flops, and swimsuits.

Facultative adaptation: When the skin is reddened due to vasodilation of the peripheral blood vessels it is because there is more blood closer to the surface of the skin, this blood allows heat to come up from the core body where it can then be easily released into the environment by radiation.

Short-term adaptation: Sweating is the production of fluids secreted through the sweat glands and it is a short-term mechanism used to release heat from the body.












3) The benefits of studying human variation from this perspective are that we are allowed to learn about how we, as humans, adapt to environmental stresses and it can demonstrate how we are more like other races than we might think. Instead of just observing that people with fair skin typically live in colder climates and people with darker skin live in more tropical climates, we can assess that it has something to do with the relationship between melanin and sunlight instead of it being race related. This type of information can be extremely helpful because we can learn biologically and physiologically why we react the way we do to certain environmental pressures. For example, learning why we sweat can lead to a number of things including learning how to prevent excessive sweating or how to regulate body temperature without it, if possible. 
4) Most Africans have long, slender limbs and bodies which I could attribute to their race rather than to the climate they live in which is generally warm. I could attribute vasodilation to white people because you can see the blood pigments easier through their skin. When using race to understand variations of adaptations, I am generalizing certain races by grouping them. For example, because most Africans are tall and slender I assume that this must be due to race but this is not true so race is an inefficient, unbiological, and generalized way to determine certain adaptations. The study of environmental influences on adaptations is a far better way to understand human variation because it reveals the biological and cultural reasons we react the way we do to environmental stress. It lets us know how our bodies are working and functioning internally and externally in certain situations. For example, the study of environmental influences can help inform us how and why our bodies react the way they do to high altitude pressures. Studies of the environment can also inform us on how natural selection works because it helps identify traits that thrive in certain climates or condition such as long limbs in warm climates.

Communication

     I had a fifteen minute conversation with my boyfriend over the weekend where I could not and did not use any form of talking, including writing. I found this experiment challenging because hand gestures and facial expressions alone were not enough to get my point across. I noticed that, unless what I was trying to communicate was obvious such as pointing at an object to indicate I want it, it was very hard for my partner to understand me. We were making food and not talking made it really difficult because I could not ask any questions so it was a rough experience. My partner kept telling me to elaborate because he could not understand me, and was talking to me differently by trying to guess what I was saying after I would point to something, it did not seem like a real conversation. After a few minutes I got a better handle on communicating this way but the conversation still seemed awkward because I could not respond with words. 

     If we represented two different cultures meeting for the first time, I think that I would have the advantage in communicating complex ideas only because gestures made like hand gestures are more universally understood and even if my partner could speak his language perfectly, I would never be able to understand him if I did not know that language or even how to talk. I feel like the speaking culture would have an inferior attitude towards the non-speaking because they would look down upon the fact that they do not know any language or speech, it would be viewed as a primitive trait. In our culture today, most people diagnosed with Autism have trouble speaking and communicating thoughts therefore it is hard for them to be understood without any type of aid. This affects someone who speaks to an Autism patient because there can be a communication barrier and a lack of understanding.

     When I experimented with having a conversation where all I could use was my voice and no physical gestures, it was difficult for me to keep up with it. I could only go a minute or two without using a hand gesture each time I tried this experiment. The longest I was able to go was five or so minutes, it was surprisingly hard for me. The most difficult part was certainly hand gestures because, and I did not realize until this experiment, I use my hands a lot while I talk. I would catch myself using my hands and forgetting I was not supposed to. It was slightly hard to focus on the conversation because I was so focused on not using my hands. My partner did not seem very affected by my lack of gestures because he understood what I was saying without it. Since I could articulate my thoughts, he could understand them just fine. 

     Our use of "signs" in language is an important and underrated staple of our communication. We base a lot of information on how a person holds their body or the way they move their hands and face while they talk. If everyone talked with no emotion on their face or in their voice, it would be hard to interpret most things. Non-speech language techniques are like a way of validating what we are saying, it can help a lot with people understanding what someone is saying. I am sure there are people with trouble reading body language because they are not good at realizing how to interpret it. Body language can be a great indicator of how someone is feeling. For example, there are psychologists that can determine how a girl feels about a boy just by the way she sits or stands when she is talking to him. If someone is lying, they give off a certain body language perhaps by crossing their arms, avoiding eye contact, or covering their mouth. If you are lying to someone you would hope they would not see these signs your body gives off. Body language helps when assessing someone and is a very useful thing to be able to detect. 

Piltdown Hoax

       During the early 1900s in Sussex, England a laborer digging near the village of Piltdown found what seemed to be a piece of fossilized skull and passed it on to Charles Dawson, an (amateur) archaeologist.  Dawson thought this skull to be a primitive, human skull so he took to the Natural History Museum and met up with Sir Arthur Smith Woodward. Woodward and Dawson spent the summer of 1912 digging and eventually found what seemed to be a jawbone with a few human-like teeth included that the men thought to be related to the piece of skull the laborer presented to Dawson; they had found the "missing link" (or so they thought). Some scientists started to wonder if the skull and jawbone were related and if it was really in fact "the earliest Englishman". One crucial part of the "Piltdown Man" was missing, the canine tooth, which would help prove Dawson's claims so a year later Dawson, Woodward, and now another man Teilhard de Chardin went back to digging and very luckily found a canine. The canine forced doubters to believe and in 1917, just a few miles from the first dig, a second "Piltdown Man" was found by Dawson and the men. 

        Then, in 1953, the Piltdown Man was announced as a fake. Kenneth Oakley from the Natural History Museum applied a chemical test to the fossils to help date them and from this he found that the Piltdown Man was much younger than originally thought. The skull had been stained with chemicals and boiled to make it look aged, the teeth had been filed down as a disguise, and the canine was painted and filed. What scientists had was essentially an old ape jawbone with no real significance, everything found at Piltdown was forged and phony. Dawson, Woodward, and Chardin were initially suspects but attention was soon turned to Sir Arthur Conan Doyle, the Sherlock Holmes creator, as the main suspect and he only lived a few miles away from the inital dig site. He was a medical scientist that specialized in fossils and frequented the dig site with Dawson. His motive is thought to be because of his belief in spiritualism (communicating with the dead) that led to his falling out with scientific community, perhaps he wanted to show them who the fools really were. Conan Doyle was thought to be a decent man, not the kind to allow so many lives to be wasted on this hoax, so attention turned back to Dawson who was labeled a "cheat" in the community after his untrustworthy move of purchasing the Castle Lodge and forcing the Sussex Archaeological Society out. Many of Dawson's other findings such as Chinese pottery were revealed as forgeries. No one in the scientific was pleased about this, it was an outrage, so much time and effort wasted on a joke.

        The biggest human fault that comes into play here is trustworthiness, scientists were too trusting of these finds. Everyone believed these to be real fossils and interpreted them to be the "missing link" which is a tall accusation to make and believe. Had someone had the bravery to truly question this and to test it sooner, as much as technology would allow at the given time, the answers would have been found much sooner and this mess could have been avoided. Scientists were so busy believing in the hype that no one was curious enough about it meaning that no one spent enough time making sure the findings were authentic. The positive aspects that revealed the skull as a fraud were research and verification. Curiosity plays a positive role here because Oakley set out to authenticate the fossils by doing a chemical test and this revealed "Piltdown Man's" real age. The mineral department at the Natural History of Museum completed tests to determine the nitrogen content of the fossils and this revealed all the tricks used to forge the fossils including the shaving down of the teeth and the staining of the fossils. 

      I don't think it is possible to remove the "human" factor from science because machines and technology alone cannot operate science, humans are necessary. I think the scientific community should be a bit more cautious with findings and studying them in depth before trusting them but humans can't be eliminated completely. Humans are needed to excavate findings, a machine could never do that, and to find and report important information such as forming hypotheses and proving theories. The combination of scientific technology and humans is what will prevent us from falling victim to such a hoax once again; that is, after all, how the hoax was proved false in the first place. Humans and technology rely on each other equally to dole out the most efficient findings and responses. The life lesson I can take from this incident, is to not blindly take information and to always research it first to obtain the validity of it. Finding the source of information given and making sure it is credible is a large part of science and life in general. 

Diet

1. A) Lemurs (Prosimians/Strepsirhini): Today, Lemurs are only found on the isolated island of Madagascar in Africa and other small, nearby islands such as the Comoros, where there are no other contenders for the Lemurs to compete with. They spend their time either up in the trees at the top of the canopy or at mid-level, or down on the ground and have adapted to be able to live on both sides of

the island - one is wet and the other is dry. Lemurs are accustomed to all ecosystems in Madagascar.
    B) Spider Monkey (New World Monkey/Platyrrhini): Spider Monkeys live in the wet, tropical rain forests in Central and South America and some can even be found in Mexico. They live mostly in the trees so they have limbs and tails strong enough to grasp branches as they move. 

    C) Baboon (Old World Monkey/Cercopithecidae): There are five species of Baboons and they can all be found in Africa and Arabia. They prefer to live in areas that are semi-arid such as savannas however a few live in tropical forests. Most of their time is spent on the ground. One species of Baboons is found in the hills along the Red Sea. 

    D) Gibbon (Lesser ape/Hylobatidae): The Gibbon can be found in the dense jungle and rain forests in South-East Asia. A majority of their time is spent up in the trees because they are mainly arboreal.

    E) Chimpanzee (Great ape/Hominidae): The natural habitat of the chimpanzee is the rain forest however they have also been known to inhabit swamps, savannas, bamboo forests, and woodlands. They spend equal time on land and in the trees. 

2. A) Smaller species of Lemurs are usually omnivorous eating plants and small insects. The larger species of Lemurs mostly eat fruit and leaves, they are herbivorous. Ring-tailed Lemurs are called opportunistic omnivores because they sometimes will eat small vertebrates and insects when it is necessary. So, just like all primates, Lemurs will eat anything edible if there is a lack of food in their regular diet. The plants on Madagascar that are most frequented by Lemurs are woody plants such as trees and shrubs.
    B) Spider Monkeys forage in small groups and find most of their food in the trees early during the day. Their diet consists of nuts, fruits, bird eggs, leaves, and spiders so they are omnivorous. 
    C) Baboons are considered opportunistic eaters and often cause problems for African farmers because they are drawn to crops. They will also eat fruit, grass, seeds, bark and roots. Baboons also have a taste for meat and will eat rodents, birds, and babies of other species such as sheep. 
    D) The arboreal Gibbons find their food in the trees and they are omnivores. They will eat anything from fruit, eggs, insects, spiders, small birds, and small reptiles. 
    E) Chimpanzees are also omnivorous. A majority of their diet consists of fruit, seeds, flowers, nuts, and leaves. They will also eat insects and eat larger animals that they hunt and kill, however this only makes up about two percent of their diet. Chimps use clever ways to get their food such as using small sticks to get termites out of a termite mound. Chimps have also been documented skillfully hunting red colobus monkeys and eating every part of the body including the brain. 

3. A) Lemur's are arboreal so spending a majority of the time up high in the trees caused their diet to evolve to what they can find up in the trees. You can find fruit, insects, and leaves in the trees where the Lemurs live and these are what make up their diet. Over time, fruits evolved in order to taste better so primates that live in trees like the Lemurs will eat the fruit and ultimately spread the seed.
   B) The floors of the Central and Southern American rain forests are almost always wet so the Spider Monkeys spend their time in the trees where you can find most of their favorite foods. Insects such as spiders also thrive and live up in the trees to evade the damp forest floor so they become prey for the Spider Monkeys. Spider Monkeys live in the top canopies of the trees where the water first reaches the leaves and fruits making them perfect for the monkeys to eat. The monkeys use the trees as shelters and homes so they evolved to eat what the tree has to give.
   C) Baboon's usually live in humid desert climates so because of that they are opportunistic eaters. Living close to humans also shapes the Baboon's diet, Baboon's often like to eat the crops of farmers. Baboons spend most of their time on the ground so they find most of their food down there however they have been known to go into the trees to eat and sleep so they eat the fruit, seeds, bark, and roots of the trees. Baboons eat grass on the ground to get their vegetation in since they are mostly on the ground with the grass rather than in the trees with the leaves. Baboons are not natural carnivores however their large canines seem to tell a different story, but these teeth are mostly for male-male competition. Baboons still use these teeth to hunt and kill the young of other animals, when necessary, such as antelopes because they are on the ground.
   D) Gibbons are solely arboreal so they have evolved in order to survive in the trees for a majority of their lives and this includes becoming accustomed to eating what the trees have to offer. So, because of this, Gibbons mainly eat fruit from the trees however they will also eat the reptiles, birds, and insects that also inhabit the trees. 
  E) Chimpanzees spend half of their time in the trees and half of their time on the ground so their diet can have a wide array. Their teeth, like ours, are designed to eat both meat and plants. Chimps are social animals so when they hunt, it is often done in packs, over time they have developed advanced skills for hunting and killing prey. Chimps usually eat things like fruit and leaves though so they have adapted to eating from the trees. When they eat things like insects, they have adapted in a way that allows them to make tools such as stripping a stick of its leaves and using it to fish insects out of a tree.

4. The environment has a very strong influence on physical and behavioral traits. For instance, diet largely relies on what the environment has to offer and the diet of these five different types of monkeys is an excellent example of that. Most of these monkeys spend most of their lives up in the trees so their diet has evolved to incorporate the fruit, leaves, spiders, insects, and small birds or reptiles that inhabit the trees and also live in this environment. However, there are subtle differences due to the subtle differences in environment. The Baboon spends most of its time on the ground because of the semi-arid climate where trees are different and less abundant compared to trees in the wet rain forest. Therefore, the Baboon eats grass and young livestock because it's mostly on the ground whereas the Gibbon eats mostly fruit from the trees. Even though these monkeys are from the same families and what not, their diets slightly vary because of their varying environments.

Analogy/Homology

1) A. Mountain Lions and House Cats share many similar qualities both behavioral and physical. For the specific homologous trait I'm going to discuss their teeth and claws. Both cats share feline ancestors, making them cousins, however house cats were domesticated around ten thousand to twelve thousand years ago. House cats are said to have descended from the Near Eastern wildcat which still inhabits countries in the Middle East; humans started to capture these cats when they started to farm. The Near Eastern wildcat had a genetic variance that allowed them to "try out" and have an interest in cohabitation with humans. Mountain Lions share common ancestors with the cheetah and other big cats and is the fourth largest big cat. Both cats depend heavily on their teeth and claws for hunting, maneuvering and so on. Both cats are also from the same subfamily: Felinae.
   B. Both cats have sophisticated, sleek, and retractable claws used for hunting they both also have rear teeth called carnassial teeth. These teeth are designed for tearing meat or other food before swallowing. Both of these qualities were inherited from their feline ancestors whom also had these traits. However, Mountain Lions use these traits more aggressively because they are wild. Mountain Lions' prey includes deer and smaller animals such as porcupines and coyotes and their teeth and claws are considerably bigger than that of a house cat's. They also have an extra toe and claw (a total of 5) on each of their front paws compared to the house cat (only 4 on every paw) and this is so they can easily clutch prey. Mountain Lions' front paws and claws are larger on their front legs than they are on their back legs which is also attributed to grasping prey while a house cat's paws and claws are generally all the same size. A house cat's diet usually consists of man-made cat food therefore they don't need the two inch canines like a Mountain Lion. Each feline has similar design in their teeth and claws, the main difference being the size, of course, because of the difference in prey. Mountain Lions need a stronger jaw in order to carry prey bigger than them.
    C. The first common ancestor of these felines is the Proailurus that lived approximately twenty-five million years ago. Proailurus was a small animal, a bit larger than the house cat, that also had sharp claws and teeth with the same uses as modern cats. This species is said to have given rise to the major felid lines. There's also the Pseudaelurus which was also similar in size to domestic cats and was the first felid to reach North America however it descended from the Proailurus.

2) A. Both Polar Bears and Snow Leopards have thick fur for insulation, coloring similar to the snow, and wide feet that act as natural snow shoes. Both species have these traits in order to survive their extreme weather conditions.
    B. Polar Bears and Snow Leopards have paws covered in fur in order to bear roaming the snow ridden ground and to protect their paws on any type of cold surface. Both animals have thick, thick fur for insulation in order to keep them warm because of the cold climates they reside in. Snow Leopards have very strong, powerful legs that allow them to leap as far as fifty feet. Polar bears also have very powerful legs but they use their power for swimming long distances. A Snow Leopard has grey fur to blend in with it's surroundings which looks similar to the white coat of the Polar Bear that also uses it for camouflage against the snow and ice, however the Snow Leopard has black spots on it to help blend in more to it's specific environment.
   C. All carnivorans evolved in North America from the same family, Miacidae. The animals in this family were carnivores like Polar Bears and Snow Leopards so they had similar traits attributed to hunting. However, I couldn't find anything on that group of carnivores that lived in climates as cold as or specifically similar to Polar Bears and Snow Leopards so they might not have had the traits specific to these animals climates such as fur on the bottom of their paws or thick fur for isolation.

My DNA strand

AGTTTACCAAGTTAGCTGAAGTTTAAATCAAGAGCTAAGTCTTGCCT

Historical Influences on Darwin

1. I believe that Jean-Baptiste Lamarck had the biggest influence on Darwin's national selection theory because he was one of the first to attempt to explain the process of evolution. Lamarck was also one of the first to connect the relationship between species and their environments. He had the fundamentals of natural selection however he didn't have it completely correct, Darwin and Wallace refined his theory.

2. Lamarck was one of the first to look into natural selection, he noticed the importance of the relationship between the environment and the organisms in and around that environment. His theory was that if there was a change in the external environment, an organism would need to evolve in order to accommodate the new surroundings and changes. However, Lamarck's theory had a serious flaw because according to his theory if an animal acquired a new trait it would be able to pass the trait down to its offspring. Darwin discovered that natural selection occurs over generations and not to specific individuals in one lifetime however Lamarck did lay down the fundamentals prior to Darwin's studies.
http://evolution.berkeley.edu/evolibrary/article/history_09

3. Lamarck directly affected the point "if the environment changes, the traits that are helpful or adaptive to that environment will be different" because he forged the path for natural selection by emphasizing the relationship between organisms and their environment and how they must adapt to their surroundings in order to survive. Although his initial theory was incorrect, it allowed Darwin to build upon it. 

4. I believe that eventually Darwin would have revealed the theory of natural selection even without Lamarck's groundwork but only because someone else probably would have been on the forefront before Darwin. Had no one been the first to discover this, whether it be Lamarck or someone else I think it would have seriously impaired Darwin's studies. Lamarck was a huge stepping stone in evolution and natural selection so I think that the conclusion would have been a little bit different if it weren't for Lamarck. Darwin studied Lamarck when he went to Edinburgh, so if Lamarck hadn't made the initial observation and no one else had either then I definitely think that Darwin's studies would have been some what paralyzed. 

5. The Catholic church opposed evolution because they thought it contradicted their beliefs that God created all beings. During Darwin's time, the theory of evolution was looked down upon because it clashed with the church. Darwin held off on publishing his first work because he wanted to obtain more data and he did not want to upset his strictly religious wife and cousin, he also knew it would be very controversial to many others. He finally published it because Wallace had a theory dangerously close to natural selection so Darwin wanted to publish his thoughts before someone else stole the opportunity. Evolution was viewed as a threat during this time so Darwin was not very eager to publish any papers quite yet.